Un protocole unique pour l’extraction de l’ADNGD à partir de bactéries et de levures

Résumé de la méthode

La méthode de l’EtNa libère de l’ADN monocaténaire à partir de bactéries et de levures avec une efficacité similaire par chauffage dans une solution alcaline à l’éthanol. La centrifugation donne un granule d’ADN brut, tandis que l’addition directe à des colonnes de silice permet la purification. Cette procédure pourrait être utilisée lorsque l’identité des microbes est inconnue, et il est important de ne pas négliger ou de biaiser des microorganismes particuliers.

Les techniques de biologie moléculaire telles que la PCR, la spectrométrie de masse et le séquençage ont été optimisées afin d’accélérer la détection et l’analyse des microorganismes (1). Les méthodes d’extraction de l’ADN, bien que centrales dans ces procédures, ont connu peu de progrès depuis l’introduction du traitement au thiocyanate de guanidine et de la purification de la colonne de silice (2). Bien que cette approche soit satisfaisante pour l’extraction de l’ADN à partir de bactéries Gram négatives, des prétraitements enzymatiques ou mécaniques sont nécessaires pour extraire des bactéries et des levures Gram positives ou acides (3, 4). Ceci est particulièrement problématique lorsque différents types de microorganismes peuvent être présents, comme dans le sang ou l’urine, et surtout lorsqu’il est important d’extraire les microorganismes avec une efficacité égale afin de ne pas biaiser les populations relatives dans les études de microbiote. Des études antérieures ont montré que des différences dans la structure de la paroi cellulaire sont à la base de ces problèmes. La couche plus épaisse de peptidoglycane dans les parois cellulaires des bactéries à Gram positif les rend plus difficiles à briser que les bactéries à Gram négatif (5). Les levures, les mycobactéries et les spores ont également des parois cellulaires plus compliquées que les bactéries à Gram négatif et à Gram positif et sont encore plus difficiles à briser. Les échantillons cliniques peuvent contenir tous ces types de microorganismes. Pour beaucoup de ces microbes, le rendement et la qualité de l’ADN peuvent varier considérablement en fonction de la méthode d’extraction de l’ADN utilisée (6), de sorte que différentes méthodes ou conditions doivent être utilisées simultanément pour chaque échantillon.

Diverses stratégies ont été tentées pour améliorer la lyse au thiocyanate de guanidine des microorganismes, y compris des traitements mécaniques, enzymatiques et chimiques seuls ou en combinaison. Les protocoles les plus universels utilisent probablement la lyse mécanique avec des billes, suivie d’une purification par colonne de silice (3, 4, 7). De tels traitements, cependant, peuvent cisailler l’ADN génomique (ADNGD) en petits fragments qui limitent la taille des amplicons PCR potentiels et peuvent également créer un biais lorsque des amplicons de tailles différentes sont envisagés (8). Ce problème devient plus complexe lorsque les échantillons contiennent des quantités inconnues de différents types de microorganismes, car différents types de billes et de temps de battement peuvent être nécessaires pour différents microbes et même différents nombres de microbes (9).

Les protocoles de lyse chimique et enzymatique sont généralement spécifiques à différents types de microorganismes et peuvent également prendre plus de temps car ils nécessitent plusieurs étapes dont la digestion enzymatique (10). De nombreuses procédures utilisent des substances toxiques (p. ex., le thiocyanate de guanidine) qui doivent être éliminées en toute sécurité ou des détergents ioniques (p. ex., SDS) qui peuvent réagir avec l’échantillon et doivent être éliminés ou neutralisés pour éviter l’inhibition de la PCR ultérieure.

Nous décrivons une procédure basée sur une technique inédite mise au point par Eric Frost et Sylvie Deslandes pour extraire l’ADN de Staphylococcus aureus à cribler pour détecter la présence du gène mecA. Leur procédure est utilisée au laboratoire de microbiologie clinique du Centre Hospitalier Universitaire de Sherbrooke (CHUS) depuis 2004. Frost et Guay ont également utilisé cette procédure pour extraire avec succès l’ADN de Mycobacterium tuberculosis pour une analyse par PCR. Il s’agit de mettre en suspension des bactéries granulées dans de l’éthanol à 61%, du NaOH 0,1 M et de chauffer la suspension pendant 10 min à 70°C. L’ADN monocaténaire (adNSS) libéré est ensuite granulé dans une microcentrifugeuse et mis en suspension pour PCR.

Le présent rapport décrit les améliorations apportées à cette procédure pour briser les bactéries Gram-négatives et Gram-positives ainsi que les levures et pour utiliser la méthode comme première étape de purification de l’ADN sur des colonnes de silice. Nous comparons cette procédure avec des kits commerciaux et des méthodes de recherche, y compris notre adaptation de la stratégie du polyéthylène glycol alcalin (11) de Chomczynski. Cette procédure, que nous appelons EtNa (Et pour éthanol et Na pour NaOH), ne nécessite pas de produits chimiques dangereux, de détergents ioniques, d’enzymes ou d’étapes mécaniques, mais est néanmoins efficace pour les bactéries et les levures.

Matériaux et méthodes

Souches bactériennes et conditions de culture

Les bactéries et levures suivantes ont été obtenues à partir de l’ATCC (Manassas, VA): Enterococcus faecalis (ATCC 51299), Proteus mirabilis (ATCC 12453), Streptococcus agalactiae (ATCC 12326), Escherichia coli (ATCC 25922), Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (ATCC 12228), Pseudomonas aeruginosa (ATCC 27853), Candida albicans (ATCC 60193), and Saccharomyces cerevisiae (ATCC 204508). The microbes were grown overnight on sheep blood agar (Oxoid, Nepean, Canada) at 37°C. One colony was then suspended in Nutrient Broth (Sigma-Aldrich, Oakville, Canada) and incubated at 37°C to a density corresponding to McFarland standard 2.0 (Thermo Scientific, Ottawa, Canada). Le nombre de bactéries (UFC/mL) a été confirmé par la méthode de comptage des plaques.

Procédures d’extraction

Extraction de l’eTNA gDNA. Des bactéries et / ou des levures dans un bouillon de 100 µL ou une solution saline ont été ajoutées à un tube de microcentrifugeuse de 1,5 mL. Quatre cent cinquante-cinq microlitres d’une solution de NaOH 240 mm, EDTA 2,7 mm, éthanol à 74% ont été ajoutés au tube et mélangés doucement pour donner des concentrations finales de NaOH 200 mm, EDTA 2,25 mM, éthanol 61%. Le tube a ensuite été chauffé à 80°C pendant 10 min et centrifugé à 16 060 × g pendant 10 min. Le surnageant a été éliminé et 100 µL d’une solution de suspension optimisée (voir Matériel supplémentaire) contenant 0,1 mm d’EDTA, 50 mm de Tris-HCl, pH 8,0, 1% de Triton-X-100 et 0,5% de Tween-20 ont été ajoutés pour solubiliser l’ADN dénaturé ; nous avons appelé la suspension résultante extrait brut d’EtNa. Alternativement, après chauffage, le mélange a été ajouté directement dans une colonne QiaAmp DNA Mini Kit (Qiagen, Toronto, Canada) pour la purification de l’ADNGD. L’extraction de l’EtNa a remplacé la lyse bactérienne médiée par l’AL ou l’ATL et a permis la liaison à la colonne. Les étapes de lavage suivantes, en commençant par le tampon AW-1, ont été suivies conformément aux instructions du fabricant. Le gDNA purifié a été élué dans 100 µL de TE et est appelé extrait pur d’EtNa. Un protocole détaillé se trouve dans le Matériel supplémentaire.

Méthodes à base de polyéthylène glycol alcalin (PEG). Comme dans la méthode originale (11), 100 µL d’un réactif composé de 60 g de PEG 200 dans 0,93 mL de KOH 2 M et 39 mL d’H2O ont été ajoutés à 1-10 µL d’échantillon liquide ou 1-10 mg d’échantillon solide. Le mélange a été incubé pendant 15 min à température ambiante pour les bactéries Gram-négatives et 10 min à 70-90°C pour les bactéries Gram-positives.

Extraction modifiée de l’ADNGD du PEG-NaOH. L’extraction a été réalisée dans un tube de 1,5 mL contenant 100 µL de bactéries en culture en bouillon ou à partir d’une colonie en suspension dans une solution saline. Il a été centrifugé à 6082 × g pendant 4 min. Quatre-vingt-dix microlitres du surnageant ont été prélevés et les bactéries ont été mises en suspension dans les 10 µL restants. Quatre-vingt-dix microlitres d’une solution de réactif PEG-NaOH composée de 60 mL de PEG 200, 5 mL de NaOH 2 M et 25 mL de H2O ont été ajoutés. Le mélange a été chauffé à 80°C pendant 10 min et agité brièvement avant utilisation. Des échantillons d’un microlitre ont été utilisés directement pour la PCR dans des réactions de 15 µL. Un protocole détaillé se trouve dans le Matériel supplémentaire.

Extraction de l’ADNGD LiOAC-SDS (12). Les microorganismes cultivés en bouillon ont été centrifugés et le surnageant éliminé, ou des colonies de bactéries ou de levures ont été prélevées sur des plaques de culture et mises en suspension dans une solution de 100 µL 200 mm LiOAc, 1% SDS. Après incubation à 70°C pendant 15 min et addition de 300 µL d’éthanol à 96%, les échantillons ont été mélangés par bref vortexage puis centrifugés pendant 3 min à 16 060 ×g. Le surnageant a été soutiré, et le culot a été dissous dans 100 µL de TE. Les débris cellulaires ont été filés par centrifugation pendant 1 min à 16 060 × g, et 1 µL du surnageant a été utilisé pour la PCR. Mini Kit ADN QiAamp. Les recommandations du fabricant ont été suivies pour tous les organismes qui comprenaient un traitement initial en tampon ATL, soit sans prétraitement (bactéries à Gram négatif), soit après un traitement avec de la lysostaphine (bactéries à Gram positif) ou de la lyticase (levure).

ChargeSwitch Mini Kit gDNA. Le kit a été acheté auprès de Life Technologies, (Burlington, Canada) et a été utilisé selon les recommandations du fabricant, à l’aide d’un rack magnétique pour séparer manuellement les billes magnétiques.

Amorces et sondes. Part of the rRNA 16S or 23S gene from bacteria was amplified with primers 16SUni783F (5′-AGGATTAGATACCCTGGTAGTCCA-3′), and 16SUni1094R (5′-ACTTAACCCAACATCTCACGACAC-3′) (13) or Uni23S1926F (5′-TAAGGTAGCGAAATTCCTTGTCGG-3′) and Uni23S2261R (5′-GGMGACCGCCCCAGTYAAAC-3′). Specific primers for S. aureus and E. faecalis were also used: EFNuc286F (5′-GCGATTGATGGTGATACGGTT-3′), EFNuc564R (5′-AGCCAAGCCTTGACGAACTAAAGC-3′) for S. aureus and 16SEntco45F (5′-ACATGCAAGTCGAACGCTTCT-3′), 16SEntco237R (5′-ACATGCAAGTCGAACGCTTCT-3′) for E. faecalis.

The primers used to amplify the partial rRNA 28S gene from yeast were: 28SUni185F (5′-TGGGTGGTAAATTCCAACCGCA-3′), 28SUni270F (5′-CAAAGTTCTTTTCATCTTTCCWTCAC-3′) (14) or 28Suni997F (5′-AGGATAGCAGAAGCTCG-3′) and 28Suni1154R (5′-CCACTAAAAGCTCTTCATTCA-3′). E. coli and C. albicans were detected in the mix with probe 23Scoli2210R (5′-/ROX/ ACGGGCCAAGGTTAGAACATCAAAC/ BHQ1/-3′), 28Salbic1092Rb (5′-/FAM/ TTGTCCACGTTCAATTAAGCAACAAGG /3IABkFQ/3′). Primers and probes were purchased from IDT (Coralville, IA).

Real-time PCR. Chaque extrait a été testé sur le thermocycleur PCR en temps réel LC480 (Roche Diagnostics, Indianapolis, IN). La PCR a été réalisée dans un volume de réaction final de 15 µL avec 0,5 µM de chaque amorce, 1 µL d’extrait d’ADNGD et 7,5 µL d’ADN LightCycler 480 SYBR Green I Master kit (Roche Diagnostics). Les conditions de cycle de PCR étaient 1 cycle à 95 ° C pendant 5 min, 40 cycles de 95 ° C pendant 10 s, 55 ° C pendant 20 s et 72 ° C pendant 45 s, suivis d’une courbe de fusion de 95 ° C pendant 5 s, 65 ° C pendant 30 s, 55 ° C pendant 30 s, puis d’une augmentation progressive jusqu’à ce que 95 ° C soit atteint. Un témoin négatif contenant tous les composants du mélange réactionnel sans l’échantillon d’ADN et un témoin positif contenant 1 µL d’un extrait d’ADN d’E. coli qui avait été amplifié avec succès précédemment ont été inclus dans chaque essai. Cette procédure a été validée en amplifiant une série de dilution d’ADN d’E. coli extrait par l’EtNa sans purification de colonne. Une efficacité de PCR de 98,5% avec un facteur d’amplification de 1,98 a été observée (calculée selon Thermo Scientific; www.thermoscientificbio.com/webtools/qpcrefficiency /) (Figure supplémentaire S1). Lors de l’utilisation de sondes, le kit Master DNA SYBR Green I a été remplacé par le kit Master de sondes LightCycler 480 (Roche Diagnostics). L’amorce directe ARNr 23S (0,2 µM), l’amorce inverse (0,07 µM) et la sonde spécifique d’E. coli (0,1 µM) ont été utilisées. Pour la levure, 0,5 µM d’amorce directe ARNr 28S, 0,1 µM d’amorce inverse et une sonde de levure spécifique de 0,08 µM ont été utilisés. Les conditions de cycle de PCR étaient 1 cycle à 95 ° C pendant 5 min, et 40 cycles de 95 ° C pendant 10 s, 67 ° C pendant 20 s, 55 ° C pendant 40 s et 72 ° C pendant 40 s.

Analyse statistique

Toutes les expériences ont été réalisées au moins en trois exemplaires, et les moyennes des valeurs sont enregistrées dans les tableaux et les figures. Des comparaisons statistiques ont été effectuées à l’aide du test t de Student.

Résultats et discussion

Pour casser les levures, nous avons augmenté la température de chauffage dans la procédure initiale de 70 ° C à 80 ° C et testé différentes concentrations de NaOH dans l’éthanol à 61% (tableau 1); 0,2 ou 0,25 M de NaOH semblait casser les levures ainsi que les bactéries Gram-positives et Gram-négatives testées. Dans des expériences ultérieures, nous avons utilisé 0,2 M de NaOH. Pour s’assurer que le chauffage des microorganismes pendant 10 min à 80 ° C dans du NaOH de 0,2 M ne dégrade pas l’ADN et ne laisse pas de résidus qui inhiberaient la PCR, des dilutions 10 fois de différents microorganismes ont été extraites avec la procédure brute standard de l’EtNa (Figure 1). Même lorsque 103 microorganismes par millilitre ont été extraits, aucune réduction de l’efficacité de la PCR n’a été notée. La procédure a aussi bien extrait le gDNA de 109 bactéries par millilitre.


Tableau 1. Extraction de l’ADN microbien à l’aide de différentes concentrations de NaOH.

Tableau 1.

Figure 1. Efficacité d’extraction des microorganismes à différentes concentrations.

Des dilutions de dix fois dans du bouillon nutritif de cultures nocturnes de microorganismes ont été extraites avec la procédure brute de l’EtNa. Des échantillons d’un microlitre ont été soumis à une PCR pour obtenir des valeurs de Cq.

La procédure d’extraction de l’EtNa serait beaucoup plus utile si elle pouvait être combinée à une extraction à base de silice et éventuellement automatisée. Étant donné que les tampons de lavage de colonne de silice contiennent 70% d’éthanol (ou plus précisément 67% car l’éthanol de qualité réactif n’est que de 96% d’éthanol), ce qui est similaire à la solution d’EtNa, et qu’ils n’éluent pas l’ADN, nous avons tenté de lier les acides nucléiques à la colonne en ajoutant directement la solution d’extraction de l’EtNa après avoir chauffé les acides nucléiques. Les premières expériences ont montré que l’extraction sur colonne était beaucoup moins efficace que l’extraction manuelle, mais nous avons observé que l’ajout d’EDTA à la solution d’extraction à une concentration finale de 2,25 mM permettait une récupération efficace sur colonnes de silice (Figure 2).

Figure 2. Effect of EDTA on silica column extraction.

L’ADN a été extrait d’échantillons de 100 µL contenant 107 équivalents d’ARNr d’E. coli avec l’EtNa contenant 0 à 5,5 mM d’EDTA. L’échantillon a été directement appliqué sur une colonne de silice (QIAamp DNA Mini Kit), lavé selon les recommandations du fabricant, et l’ADN a été élué dans le tampon d’élution du fabricant. Des échantillons d’un microlitre ont été soumis à une PCR pour obtenir des valeurs de Cq.

Des valeurs de Cq ont été obtenues par PCR en temps réel pour plusieurs microorganismes différents représentant des bactéries Gram négatives, des bactéries Gram positives et des levures après extraction pure de l’EtNa, y compris la purification de la colonne de silice. En utilisant la valeur de Cq d’E. coli observée de 13,25 comme référence pour 1,4 × 109 copies du gène de l’ARNr en fonction du nombre de bactéries et du nombre de copies du gène de l’ARNr (15), nous avons tracé une courbe de nombre de copies du gène de l’ARNr en fonction de ce point et de l’efficacité d’amplification de notre réaction de PCR (voir Figure supplémentaire S1). En utilisant cette courbe, nous avons estimé les valeurs de Cq qui seraient obtenues à partir du nombre de copies de gènes de l’ARNr des organismes que nous avons extraits. Nous avons observé une concordance des valeurs Cq avec une variation d’environ 1 Cq, ce qui indiquerait une variation des titres relatifs entre 0,5 et 2 fois les valeurs attendues (tableau 2). Des mélanges de différents microorganismes représentant des bactéries Gram négatives, des bactéries Gram positives et des levures à différentes concentrations ont été extraits avec le protocole d’extraction pure de l’EtNa comprenant la purification de la colonne de silice, et l’ADN extrait a été amplifié à l’aide de réactions de PCR spécifiques aux différents microorganismes. Nous avons observé que la présence d’autres microorganismes n’affectait pas l’efficacité d’extraction des bactéries ou des levures, avec une variation de concentration supérieure à 100 fois (Tableau 3).


Tableau 2. gDNA extraction efficacy of EtNa for different types of microorganisms.

Table 2.

Table 3. Extraction of mixtures of microorganisms.

Table 3.

L’EtNa brut et l’EtNa pur ont été comparés à diverses méthodes d’extraction de l’ADN, y compris le Mini Kit d’ADN QiaAmp commercial et le Mini Kit d’ADN GDNA de ChargeSwitch qui sont basés sur la rupture du thiocyanate de guanidine et la purification de la colonne de silice, ainsi que les procédures LiOAc-SDS et alkaline PEG. Toutes les méthodes ont permis d’extraire l’ADN bactérien avec succès, mais seuls l’EtNa et le LiOAc-SDS ont réussi à extraire l’ADNGD de la levure (tableau 4). Les valeurs de Cq légèrement plus élevées observées pour l’EtNa pur par rapport au brut de l’EtNa sont probablement le résultat de la récupération attendue suggérée par le fabricant du Mini Kit d’ADN QiaAmp.


Tableau 4. Comparaison des méthodes d’extraction de l’ADNGD par PCR en temps réel.

Tableau 4.

Au cours des 25 dernières années, la plupart des protocoles de rupture des microorganismes et de purification de leurs acides nucléiques ont fait appel à un traitement au thiocyanate de guanidinium après affaiblissement enzymatique ou mécanique des parois cellulaires Gram-positives ou de levure (mais sans prétraitement pour les bactéries Gram-négatives), puis à une purification sur colonnes de silice (2). Le remplacement de l’un de ces deux éléments nécessiterait donc des améliorations significatives. Nous décrivons ici une telle stratégie de rupture de microbes, appelée EtNa, qui est efficace pour tous les types d’organismes et de cellules, ne nécessite pas de produits chimiques dangereux, est rapide et peut être intégrée à la purification de colonnes de silice ou utilisée comme extrait brut rapide pour les tests d’amplification de l’ADN. Bien que cette procédure donne un adNSS plutôt qu’un ADN double brin (adNSD) tel qu’obtenu avec l’extraction au thiocyanate de guanidinium, cela devrait être un avantage pour la PCR et ne devrait pas empêcher le séquençage standard ou de prochaine génération, car des protocoles existent pour préparer des banques de séquençage à partir d’acides nucléiques monocaténaires. D’autre part, cela empêcherait l’extraction de l’ARN et les protocoles nécessitant une digestion par endonucléase de restriction.

Le plus grand avantage de l’EtNa est probablement que le même protocole peut être utilisé pour tous les types de microorganismes à n’importe quelle concentration avec une efficacité similaire. Ceci est particulièrement important pour les tests de dépistage des infections humaines ou autres lorsque l’organisme responsable n’est pas connu et peut être une bactérie ou une levure à Gram négatif ou à Gram positif. Il sera également de plus en plus important de caractériser le microbiote dans de nombreux sites où, là encore, une variété de microorganismes coexistent et où il est important de les extraire avec une efficacité équivalente afin que leur abondance relative puisse être reflétée par le séquençage ultérieur de la prochaine génération d’ARNr 16S ou d’autres gènes. En effet, nous avons observé que l’EtNa fonctionnait avec une efficacité similaire lors de l’extraction de petits (103 / mL) ou grands (109 /mL) nombres de micro-organismes.

La procédure de l’EtNa ne nécessite pas de produits chimiques dangereux tels que le thiocyanate de guanidinium ou le phénol. Il ne nécessite pas de détergents ioniques susceptibles d’interférer avec les enzymes nécessaires aux tests ultérieurs tels que la PCR. Il donne un ADNSS dénaturé et dégrade l’ARN. Bien qu’inapproprié lorsque les tests en aval nécessitent de l’ARN ou de l’ADNc, cela est avantageux pour les procédures basées sur la PCR car cela réduit l’importance de l’étape de chauffage initiale nécessaire pour dénaturer l’ADN avant la PCR.

On sait depuis longtemps que la chaleur (16) ou l’alcali (17) peuvent être utilisés pour décomposer les parois cellulaires d’E. coli et extraire l’ADN plasmidique. Nous avons postulé que la combinaison de la chaleur et de l’alcali avec de l’éthanol à 61% pour perturber les membranes lipidiques augmenterait la rupture de la paroi cellulaire et précipiterait simultanément l’ADN libéré, permettant une préparation très rapide d’extraits d’ADN bruts. Cet éthanol à 61% créerait également un environnement chaotropique qui permettrait à l’ADN de se lier à la silice. Il a été noté que l’ajout d’EDTA supplémentaire améliorait la liaison à la silice. Cette découverte était en effet fortuite car une procédure de rupture microbienne qui ne pourrait être couplée efficacement à une purification sur silice n’aurait qu’une utilité limitée.

En conclusion, nous avons développé une méthode rapide, peu coûteuse et fiable pour casser les cellules de levure et de bactéries avant l’extraction de l’ADNGD. Le réactif EtNa peut être utilisé pour traiter une large gamme d’échantillons biologiques pour le dosage par PCR dans le diagnostic clinique et la recherche biomédicale en <25 min. L’adNSS issu de cette procédure peut être utilisé directement ou purifié en le liant directement aux colonnes de silice de la solution d’EtNa. La méthode EtNa doit être compatible avec l’automatisation des robots de traitement d’échantillons.

Contributions des auteurs

L.V. a contribué à la conception de l’étude, à l’acquisition des données, à l’analyse et à l’interprétation des données, à la rédaction de l’article et à la révision critique. E.H.F. a contribué à la conception de l’étude, de l’analyse et de l’interprétation des données, à la rédaction de l’article, à la révision critique et à la supervision générale.

Remerciements

Les auteurs remercient Sylvie Deslandes pour son rôle dans le développement de l’extraction initiale de l’ADNGD utilisée au laboratoire de microbiologie clinique du Centre Hospitalier Universitaire de Sherbrooke et les membres du laboratoire de microbiologie clinique du Centre Hospitalier Universitaire de Sherbrooke pour les souches de bactéries. Geneviève Giroux, Stéphanie Mauler, Karine Bourgade, Evelyne Benoit et Patrick Dextras-Paquette sont remerciés pour leurs discussions utiles et leur soutien expérimental.

Intérêts concurrents

Les auteurs ne déclarent aucun intérêt concurrent.

Données supplémentaires

Pour consulter les données supplémentaires qui accompagnent le présent article, veuillez visiter le site Web de la revue à l’adresse suivante : www.future-science.com/doi/suppl/10.2144/000114263

  • 1. Burillo, A., B. Rodriguez-Sanchez, A. Ramiro, E. Cercenado, M. Rodriguez-Creixems et E. Bouza. 2014. Gram-stain plus MALDI-TOF MS (Ionisation par Désorption Laser Assistée par Matrice – Spectrométrie de masse à temps de vol) pour un diagnostic rapide d’infection des voies urinaires. PLoS ONE 9: e86915.Les résultats de cette étude sont les suivants : Il s’agit de l’une des principales sources d’information sur la santé et la sécurité au travail. 1990. Méthode rapide et simple de purification des acides nucléiques. J. Clin. Microbiol. 28:495–503.Medline, CAS, Google Scholar
  • 3. Il s’agit de l’un des principaux facteurs de risque de la maladie. 2011. L’extraction de l’ADN microbien à partir de biopsies intestinales est améliorée en évitant la perturbation mécanique des cellules. J. Microbiol. Méthodes 87:125-127.Crossref, Medline, CAS, Google Scholar
  • 4. Salonen, A., J. Nikkilä, J. Jalanka-Tuovinen, O. Immonen, M. Rajilic-Stojanovic, R.A. Kekkonen, A. Palva et W.M. de Vos. 2010. Analyse comparative des méthodes d’extraction de l’ADN fécal avec microarray phylogénétique: récupération efficace de l’ADN bactérien et archéen par lyse cellulaire mécanique. J. Microbiol. Méthodes 81:127-134.Crossref, Medline, CAS, Google Scholar
  • 5. Swidsinski, A., V. Loening-Baucke, H. Verstraelen, S. Osowska et Y. Doerffel. 2008. Biostructure of fecal microbiota in healthy subjects and patients with chronic idiopathic diarrhea. Gastroentérologie 135:568-579.Les résultats de cette étude sont les suivants : Cuív, P.O., D. Aguirre de Cárcer, M. Jones, E.S. Klaassens, D.L. Worthley, V.L.J. Whitehall, S. Kang, C. McSweeney, B.A. Leggett et M. Morrison. 2011. Les effets des méthodes d’extraction de l’ADN sur l’évaluation de la diversité microbienne associée au tissu colique humain. Microb. Ecol. 61:353–362.Crossref, Medline, CAS, Google Scholar
  • 7. Il s’agit de l’un des principaux ouvrages de l’auteur. 2012. Évaluation des méthodes d’extraction et de purification de l’ADN du microbiome humain. PLoS ONE 7: e33865.Crossref, Medline, CAS, Google Scholar
  • 8. Liesack, W., H. Weyland et E. Stackebrandt. 1991. Risques potentiels d’amplification génique par PCR tels que déterminés par l’analyse de l’ADNr 16S d’une culture mixte de bactéries barophiles strictes. Microb. Ecol. 21:191–198.Crossref, Medline, CAS, Google Scholar
  • 9. Rantakokko-Jalava, K. et J. Jalava. 2002. Méthode optimale d’isolement de l’ADN pour la détection de bactéries dans des échantillons cliniques par PCR à large plage. J. Clin. Microbiol. 40:4211–4217.Les résultats de cette étude sont les suivants : Hohnadel, M., L. Feldan, D. Fijuljanin, S. Jouette et R. Chollet. 2014. Un nouvel instrument à ultrasons à haut débit pour une libération rapide d’ADN par des micro-organismes. J. Microbiol. Méthodes 99:71-80.Les résultats de cette étude sont les suivants : Il s’agit de la première édition de la revue. 2006. Méthode alcaline à base de polyéthylène glycol pour la PCR directe à partir de bactéries, d’échantillons de tissus eucaryotes et de sang total. Biotechniques 40:454-458.Lien, CAS, Google Scholar
  • 12. Lõoke, M., K. Kristjuhan et A. Kristjuhan. 2011. Extraction d’ADN génomique à partir de levures pour des applications basées sur la PCR. Biotechniques 50:325-328.Lien, CAS, Google Scholar
  • 13. Il s’agit de l’un des principaux ouvrages de référence en matière de santé publique. 1995. Détection de Pseudomonas (Burkholderia) cepacia par PCR. Pédiatre. Pneumol. 20:44–49.Les résultats de cette étude sont les suivants : Basková, L., C. Landlinger, S. Preuner et T. Lion. 2007. Le test Pan-AC: un test PCR en temps réel à réaction unique pour la détection quantitative d’une large gamme d’espèces d’Aspergillus et de Candida. J. Med. Microbiol. 56:1167–1173.Les résultats de cette étude sont les suivants : Wattam, A.R., D. Abraham, O. Dalay, T.L. Disz, T. Driscoll, J.L. Gabbard, J.J. Gillespie, R. Gough, et al.. 2014. PATRIC, la base de données et ressource d’analyse en bioinformatique bactérienne. Acides nucléiques Res. 42 (D1): D581-D591.Les résultats de cette étude sont les suivants : Il y a des gens qui ont des problèmes de santé et qui ont des problèmes de santé. 1981. Une méthode d’ébullition rapide pour la préparation de plasmides bactériens. Anal. Biochem. 114:193–197.Crossref, Medline, CAS, Google Scholar
  • 17. Birnboim, H.C. and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523.Crossref, Medline, CAS, Google Scholar

Laisser un commentaire

Votre adresse e-mail ne sera pas publiée. Les champs obligatoires sont indiqués avec *